Visita la página TERAPIA REGENERATIVA

Visita la página TERAPIA REGENERATIVA
Nueva Página http://www.terapiaregenerativa.com

martes, 27 de septiembre de 2011

LOS ÁCIDOS NUCLEICOS (ADN y ARN)

http://www.iespando.com/web/departamentos/biogeo/web/departamento/2BCH/B4_INFORMACION/T402_ACIDNUCLE/informacion.htm

Índice: Concepto. Funciones generales. Los nucleótidos: componentes. Nucleótidos o derivados de interés biológico. Los polinucleótidos. El ADN: Estructuras (primaria y secundaria). Estructuras terciaria y superiores en eucariotas. Tipos de ADN. El ARN: Clases.

2) LOS ÁCIDOS NUCLEICOS

CONCEPTO

Químicamente, los ácidos nucleicos son polímeros constituidos por la unión mediante enlaces químicos de unidades menores llamadas nucleótidos. Los ácidos nucleicos son compuestos de elevado peso molecular, esto es, son macromoléculas.

FUNCIONES GENERALES

Los ácidos nucleicos, llamados así porque en un principio fueron localizados en el núcleo celular, son las moléculas de la herencia y por lo tanto van a participar en los mecanismos mediante los cuales la información genética se almacena, replica y transcribe. Ésta no va a ser su única función. Determinados derivados de estas sustancias: los nucleótidos, van a tener otras funciones biológicas, entre las que pueden destacarse, como ejemplo, la de servir de intermediarios en las transferencias de energía en las células (ATP, ADP y otros) o en las transferencias de electrones (NAD+, NADP+, FAD, etc.).

LOS NUCLEÓTIDOS: COMPONENTES

Los nucleótidos están formados por: una base nitrogenada (BN), un azúcar (A) y ácido fosfórico (P); unidos en el siguiente orden: P-A-BN

LAS BASES NITROGENADAS

Son sustancias derivadas de dos compuestos químicos: la purina y la pirimidina. Las que derivan de la purina son las bases púricas. En los nucleótidos vamos a encontrar, normalmente, dos base púricas: la adenina (A) y la guanina (G). Las que derivan de la pirimidina se llaman pirimidínicas. Tres son las bases pirimidínicas presentes en los ácidos nucleicos: la citosina (C), la timina (T) y el uracilo (U).

En ciertos casos, aunque esto pasa muy raramente, pueden encontrarse en los ácidos nucleicos otras bases diferentes de estas cinco, por lo general derivados metilados de ellas.

EL AZÚCAR (GLÚCIDO)

El azúcar que interviene en los nucleótidos puede ser o la ribosa (R) o la desoxirribosa (dR). Ambas son aldopentosas y las encontraremos en los nucleótidos como ß-furanosas.

Conviene destacar que la única diferencia entre ambas está en que en el carbono 2 de la desoxirribosa hay un hidrógeno (-H) en lugar del grupo alcohol (-OH).

LOS NUCLEÓSIDOS

El azúcar y la base nitrogenada se unen entre sí como se indica en las figuras formando un nucleósido. El enlace se forma entre el carbono anomérico del azúcar y uno de los nitrógenos de la base nitrogenada, en concreto, el indicado en las figuras. En la unión se forma una molécula de agua. Este enlace recibe el nombre de enlace N-glicosídico.

ESTRUCTURA DE LOS NUCLEÓTIDOS

Los nucleótidos son los monómeros que constituyen los ácidos nucleicos. Se forman cuando se unen el ácido fosfórico y un nucleósido. Es una unión fosfoéster entre un OH del ácido fosfórico y el OH situado en el carbono 5 del azúcar, con formación de una molécula de agua. Según el azúcar sea la ribosa o la desoxirribosa, tendremos ribonucleótidos o desoxirribonucleótidos. La timina nunca forma parte de los ribonucleótidos y el uracilo no forma parte de los desoxirribonucleótidos.

NUCLEÓTIDOS O DERIVADOS DE NUCLEÓTIDOS DE INTERÉS BIOLÓGICO.

Algunos nucleótidos cumplen funciones por sí mismos. Así, por ejemplo:

a) Nucleótidos que intervienen en las transferencias de energía: Se trata de moléculas que captan o desprenden energía al transformarse unas en otras. Así, el ATP desprende energía cuando se hidroliza, transformándose en ADP y fosfato inorgánico (Pi). Por el contrario, el ADP almacena energía cuando reacciona con el fosfato inorgánico y se transforma en ATP y agua. De esta forma se transporta energía (unas 7 kilocalorías por mol de ADP/ATP) de aquellas reacciones en las que se desprende (exergónicas) a aquellas en las que se necesita (endergónicas).

Ejemplos de nucleótidos transportadores de energía:

- AMP (adenosina-5'-monofosfato) A-R-P

- ADP (adenosina-5'-difosfato) A-R-P-P

- ATP (adenosina-5'-trifosfato) A-R-P-P-P

- GDP (guanosidina-5'-difosfato) G-R-P-P

- GTP (guanosidina-5'-trifosfato) G-R-P-P-P

b) Nucleótidos que intervienen en los procesos de óxido-reducción. Estas moléculas captan electrones de moléculas a las que oxidan y los ceden a otras moléculas a las que a su vez reducen. Así, el NAD+ puede captar 2e- transformándose en su forma reducida, el NADH, y éste puede ceder dos electrones a otras sustancias, reduciéndolas y volviendo a transformarse en su forma oxidada, el NAD+. Así, se transportan electrones de aquellas reacciones en las que se desprende a aquellas en las que se necesitan.

Ejemplos de nucleótidos transportadores de electrones:

- NAD+/NADH (Nicotinamida-adenina-dinucleótido) oxidado y reducido, respectivamente.

- NADP+/NADPH (Nicotinamida-adenina-dinucleótido-fosfato), oxidado y reducido.

- FAD/FADH2 (Flavina-adenina-dinucleótido), oxidado y reducido.

c) Nucleótidos reguladores de procesos metabólicos. Algunos nucleótidos cumplen funciones especiales como reguladores de procesos metabólicos, por ejemplo el AMPc (adenosina-3',5'-monofosfato) o AMP cíclico, en el que dos OH del fosfato esterifican los OH en posiciones 3 y 5 de la ribosa formando un ciclo. Este compuesto químico actúa en las células como intermediario de muchas hormonas.

LOS POLINUCLEÓTIDOS

Dos nucleótidos van a poder unirse entre sí mediante un enlace ésterfosfato (fosfoéster). Este enlace se forma entre un OH del ácido fosfórico de un nucleótido y el OH (hidroxilo) del carbono número 3 del azúcar del otro nucleótido con formación de una molécula de agua. La unión de otros nucleótidos dará lugar a un polinucleótido.

Es de destacar que en toda cadena de polinucleótidos el nucleótido de uno de los extremos tendrá libre el OH del azúcar en posición 3, éste será el extremo 3' de la cadena. El ácido fosfórico del nucleótido que se encuentre en el extremo opuesto también estará libre, éste será el extremo 5'. Esto marca un sentido en la cadena de polinucleótidos. Toda cadena podrá considerarse bien en sentido 3'ð5' o en sentido 5'ð3' y así habrá que indicarlo.

ADN Y ARN: DIFERENCIAS A NIVEL QUÍMICO

- El ADN (ácido desoxirribonucleico) sus nucleótidos tienen desoxirribosa como azúcar y no tiene uracilo.

- El ARN (ácido ribonucleico) tiene ribosa y no tiene timina.

EL ADN (DNA)

Concepto: Químicamente son polinucleótidos constituidos por d-AMP, d-GMP, d-CMP y d-TMP. Los nucleótidos del ADN no tienen ni uracilo, ni ribosa, como ya se ha dicho.

Características: Los ADN celulares tienen una elevada masa molecular, muchos millones de daltons. Así, por ejemplo: el genoma humano está formado por 3x109 pares de nucleótidos. Esto hace que sean moléculas de una gran longitud; por ejemplo: 1,7 µm en el caso del virus de la poliomielitis y 2,36 m si sumamos todo el ADN de todos los cromosomas de una célula humana.

El ADN fue aislado por primera vez en 1869, pero hasta 1950 no se empezó a conocer su estructura. Se encuentra en el núcleo de las células eucariotas asociado a proteínas (histonas y otras) formando la cromatina, sustancia que constituye los cromosomas y a partir de la cual se transcribe la información genética. También hay ADN en ciertos orgánulos celulares (por ejemplo: plastos y mitocondrias).

ESTRUCTURA DEL ADN

Se pueden distinguir 3 niveles estructurales:

- Estructura primaria: La secuencia de los nucleótidos.

- Estructura secundaria: La doble hélice.

- Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado.

En las células eucariotas, a partir de la estructura 3ª, se dan otros niveles de empaquetamiento de orden superior.

ESTRUCTURA PRIMARIA DEL ADN.

Es la secuencia de nucleótidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucleótidos en la hebra o cadena de la molécula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotídica.

Así, por ejemplo:

5'ACGTTTAACGACAAGTATTAAGACAAGTATTAA3'

La posibilidad de combinar cuatro nucleótidos diferentes y la gran longitud que pueden tener las cadenas polinucleotídicas, hacen que pueda haber un elevado número de polinucleótidos posibles, lo que determina que el ADN pueda contener el mensaje biológico o información genética y explica la diversidad del mensaje genético de todos los seres vivos.


ESTRUCTURA SECUNDARIA DEL ADN.

Datos preliminares:

A) A finales de los años 40 Erwin CHARGAFF y sus colaboradores estudiaron los componentes del ADN y emitieron los siguientes resultados:

a) La concentración de bases varía de una especie a otra. El porcentaje de A, G, C y T es el mismo en los individuos de la misma especie y no por esto el mensaje es el mismo.

b) Tejidos diferentes de la misma especie tienen la misma composición en bases.

c) La composición en bases del ADN de una misma especie no varía con la edad del organismo ni con su estado nutricional ni con las variaciones ambientales.

d) Las densidades y viscosidades corresponden a la existencia de enlaces de hidrógeno entre los grupos NH y los grupos CO.

e) La concentración de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. Las dos primeras establecen dos puentes de hidrógeno entre ellas, y las últimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas.

B) Por medio del método analítico de difracción de rayos X, FRANKLIN y WILKINS observaron una estructura fibrilar de 20 Å (Amstrongs) de diámetro con repeticiones cada 3,4 Å y una mayor cada 34 Å.

C) WATSON y CRICK postularon en 1953 un modelo tridimensional para la estructura del ADN que estaba de acuerdo con todos los datos disponibles anteriores: el modelo de doble hélice. Este modelo, además de explicar cómo era el ADN, sugería los mecanismos que explicaban su función biológica y la forma como se replicaba.

Según el modelo de la doble hélice de WATSON y CRICK:

1º) El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladas helicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice.

2º) Ambas cadenas serían antiparalelas, una iría en sentido 3'ð5' y la otra en sentido inverso, 5'ð3'.

3º) Los grupos fosfato estarían hacia el exterior y de este modo sus cargas negativas interaccionarían con los cationes presentes en el nucleoplasma dando más estabilidad a la molécula.

4º) Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelos entre sí y las bases de cada una de las hélices estarían apareadas con las de la otra asociándose mediante puentes de hidrógeno.

5º) El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y la guanina y la citosina, por la otra[1]. Por lo tanto, la estructura primaria de una cadena estaría determinada por la de la otra, ambas cadenas serían complementarias.

La complementariedad de las cadenas sugiere el mecanismo por el cual el ADN se copia -se replica- para ser trasferido a las células hijas. Ambas cadenas o hebras se pueden separar parcialmente y servir de molde para la síntesis de una nueva cadena complementaria (síntesis semiconservativa).

PROPIEDADES DE LA ESTRUCTURA SECUNDARIA DEL ADN: DESNATURALIZACIÓN

Si una disolución de ADN se calienta suficientemente ambas cadenas se separan, pues se rompen los enlaces de hidrógeno que unen las bases, y el ADN se desnaturaliza. La temperatura de desnaturalización depende de la proporción de bases. A mayor proporción de C-G, mayor temperatura de desnaturalización, pues la citosina y la guanina establecen tres puentes de hidrógeno, mientras que la adenina y la timina sólo dos y, por lo tanto, a mayor proporción de C-G, más puentes de hidrógeno unirán ambas cadenas. La desnaturalización se produce también variando el pH o a concentraciones salinas elevadas. Si se restablecen las condiciones, el ADN se renaturaliza y ambas cadenas se unen de nuevo.

ESTRUCTURA TERCIARIA DEL ADN EN LAS CÉLULAS EUCARIOTAS.

Las grandes moléculas de ADN de las células eucariotas están muy empaquetadas ocupando así menos espacio en el núcleo celular y además como mecanismo para preservar su transcripción .

Como hemos visto, en las células eucariotas el ADN se encuentra en el núcleo asociado a ciertas proteínas: nucleoproteínas, formando la cromatina. En la cromatina, la doble hélice de ADN se enrolla alrededor de unas moléculas proteicas globulares, las histonas, formando los nucleosomas. Cada nucleosoma contiene 8 histonas y la doble hélice de ADN da dos vueltas a su alrededor (200 pares de bases). El conjunto, si no está más empaquetado aún, forma una estructura arrosariada llamada collar de perlas. Ahora bien, los nucleosomas pueden empaquetarse formando fibras de un grosor de 30 nm (fibra de 30 nm). Según el modelo del solenoide las fibras se forman al enrollarse seis nucleosomas por vuelta alrededor de un eje formado por las histonas H1.

NIVELES SUPERIORES DE EMPAQUETAMIENTO

Los siguientes niveles de empaquetamiento no están aún aclarados del todo pero, parece ser, que cada fibra se volvería a enrollar formando un bucle (cada bucle tendría 50 millones de pares de bases), seis bucles se empaquetarían asociándose a un "esqueleto nuclear" produciéndose un rosetón, 30 rosetones formarían una espiral y 20 espirales formarían una cromátida. Todo ello produciría un gran acortamiento de las largas cadenas de ADN.

En los espermatozoides el ADN se encuentra aún mucho más empaquetado, se dice que tiene "estructura cristalina".

Los ADN de las bacterias, virus, mitocondrias y plastos no presentan estructuras tan complejas y no están asociados a histonas, aunque sí están asociados a otras proteínas.

TIPOS DE ADN

Según su estructura se distinguen los siguientes tipos de ADN:

- Monocatenarios o de una cadena; por ejemplo los de algunos virus.

- Bicatenarios, con dos hebras o cadenas (el resto de los virus, las bacterias y los eucariotas).

A su vez, y en ambos casos, el ADN puede ser:

- Lineal, como por ejemplo el del núcleo de las células eucariotas y el de algunos virus.

- Circular, como el de las mitocondrias, cloroplastos, bacterias y algunos virus.

EL ARN (RNA). DIFERENCIAS CON EL ADN

El ARN, ácido ribonucleico, es un polirribonucleótido que, a diferencia del ADN, no contiene ni desoxirribosa ni timina, pero sí ribosa y uracilo. El ARN no forma dobles cadenas, salvo en ciertos virus (por ej. los reovirus). Lo que no quita que su estructura espacial pueda ser en ciertos casos muy compleja.

CLASES DE ARN

Por su estructura y su función se distinguen tres clases de ARN:

- El ARNm (ARN mensajero) es un polirribonucleótido constituido por una única cadena sin ninguna estructura de orden superior. Su masa molecular suele ser elevada. Este ARN se sintetiza en el núcleo celular y pasa al citoplasma transportando la información para la síntesis de proteínas. La duración de los ARNm en el citoplasma celular es de escasos minutos siendo degradados rápidamente por enzimas específicas.

- El ARNt (ARN de transferencia) transporta los aminoácidos para la síntesis de proteínas. Está formado por una sola cadena, aunque en ciertas zonas se encuentra replegada y asociada internamente mediante puentes de hidrógeno entre bases complementarias. Su peso molecular es del orden de 25.000 da. Está formado por entre 70 y 90 nucleótidos y constituye el 15 % del total del ARN de la célula. Se sintetiza en el núcleo y sale hacia el citoplasma para realizar su función. En el ARNt podemos distinguir un brazo aceptor de aminoácidos abierto y un bucle anticodon.

- El ARNr (ARN ribosomal) es el ARN de los ribosomas, cuya función es poco conocida.